human crispri dual sgrna libraries Search Results


96
New England Biolabs engen sgrna synthesis kit
Engen Sgrna Synthesis Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispri+dual+sgrna+libraries/EnGen+sgRNA+Synthesis+Kit/pm37172641-65-10-14
Average 96 stars, based on 1 article reviews
engen sgrna synthesis kit - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

95
Addgene inc circular plasmid dna homology
Circular Plasmid Dna Homology, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispri+dual+sgrna+libraries/sgRNA(MS2)+cloning+backbone+(Plasmid+%2361424)/pm25271839-60-67-96
Average 95 stars, based on 1 article reviews
circular plasmid dna homology - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

97
Addgene inc bicistronic cas9 sgrna vector
(a) Experimental schematic. Cultured cells were co-transfected with a single <t>Cas9-sgRNA</t> construct (CRISPR) and a complex homology-directed repair (HDR) library containing an edited exon that harbors a random hexamer (blue, green, orange) and a fixed selective PCR site (red). CRISPR-induced cutting stimulated homologous recombination with the HDR library, inserting mutant exons into the genomes of many cells. At five days post-transfection, cells were harvested for gDNA and RNA. After reverse transcription, selective PCR was performed followed by sequencing of gDNA and cDNA derived amplicons. Hexamer enrichment scores were calculated by dividing cDNA counts normalized by gDNA counts. (b) Correlation of enrichment scores between biological replicates for hexamers observed in each experiment with positions of previously identified exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs) and stop codons indicated. (c) Rank-ordered plot of enrichment scores with positions of ESEs, ESSs, and stop codons indicated.
Bicistronic Cas9 Sgrna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispri+dual+sgrna+libraries/Cas9+sgRNA+vector+(Plasmid+%2368463)/pmc04156553-37-1-38
Average 97 stars, based on 1 article reviews
bicistronic cas9 sgrna vector - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

96
Addgene inc human crispr knockout pooled library brunello addgene
(a) Experimental schematic. Cultured cells were co-transfected with a single <t>Cas9-sgRNA</t> construct (CRISPR) and a complex homology-directed repair (HDR) library containing an edited exon that harbors a random hexamer (blue, green, orange) and a fixed selective PCR site (red). CRISPR-induced cutting stimulated homologous recombination with the HDR library, inserting mutant exons into the genomes of many cells. At five days post-transfection, cells were harvested for gDNA and RNA. After reverse transcription, selective PCR was performed followed by sequencing of gDNA and cDNA derived amplicons. Hexamer enrichment scores were calculated by dividing cDNA counts normalized by gDNA counts. (b) Correlation of enrichment scores between biological replicates for hexamers observed in each experiment with positions of previously identified exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs) and stop codons indicated. (c) Rank-ordered plot of enrichment scores with positions of ESEs, ESSs, and stop codons indicated.
Human Crispr Knockout Pooled Library Brunello Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispri+dual+sgrna+libraries/Human+CRISPR+Knockout+Pooled+Library+(Brunello)+(Pooled+Library+%2373179%2C+%2373179-LV%2C+%2373178%2C+%2373178-LV)/pm37683639-195-67-73
Average 96 stars, based on 1 article reviews
human crispr knockout pooled library brunello addgene - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

93
Addgene inc lentiviral sgrna library
(a) Experimental schematic. Cultured cells were co-transfected with a single <t>Cas9-sgRNA</t> construct (CRISPR) and a complex homology-directed repair (HDR) library containing an edited exon that harbors a random hexamer (blue, green, orange) and a fixed selective PCR site (red). CRISPR-induced cutting stimulated homologous recombination with the HDR library, inserting mutant exons into the genomes of many cells. At five days post-transfection, cells were harvested for gDNA and RNA. After reverse transcription, selective PCR was performed followed by sequencing of gDNA and cDNA derived amplicons. Hexamer enrichment scores were calculated by dividing cDNA counts normalized by gDNA counts. (b) Correlation of enrichment scores between biological replicates for hexamers observed in each experiment with positions of previously identified exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs) and stop codons indicated. (c) Rank-ordered plot of enrichment scores with positions of ESEs, ESSs, and stop codons indicated.
Lentiviral Sgrna Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispri+dual+sgrna+libraries/Human+Lentiviral+CRISPR+Library+v1+(Pooled+Library+%2369763)/10__1038_slash_s41589___019___0291___9-371-11-17
Average 93 stars, based on 1 article reviews
lentiviral sgrna library - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp actb mm02619580 g1
(a) Experimental schematic. Cultured cells were co-transfected with a single <t>Cas9-sgRNA</t> construct (CRISPR) and a complex homology-directed repair (HDR) library containing an edited exon that harbors a random hexamer (blue, green, orange) and a fixed selective PCR site (red). CRISPR-induced cutting stimulated homologous recombination with the HDR library, inserting mutant exons into the genomes of many cells. At five days post-transfection, cells were harvested for gDNA and RNA. After reverse transcription, selective PCR was performed followed by sequencing of gDNA and cDNA derived amplicons. Hexamer enrichment scores were calculated by dividing cDNA counts normalized by gDNA counts. (b) Correlation of enrichment scores between biological replicates for hexamers observed in each experiment with positions of previously identified exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs) and stop codons indicated. (c) Rank-ordered plot of enrichment scores with positions of ESEs, ESSs, and stop codons indicated.
Gene Exp Actb Mm02619580 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispri+dual+sgrna+libraries/Gene+Exp%2E+Actb%2C+Mm02619580_g1/pm32516591-268-266-264
Average 99 stars, based on 1 article reviews
gene exp actb mm02619580 g1 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
Addgene inc cloning sgrna sequence for erβ caccgtctgcagcgattacgcatc
(a) Experimental schematic. Cultured cells were co-transfected with a single <t>Cas9-sgRNA</t> construct (CRISPR) and a complex homology-directed repair (HDR) library containing an edited exon that harbors a random hexamer (blue, green, orange) and a fixed selective PCR site (red). CRISPR-induced cutting stimulated homologous recombination with the HDR library, inserting mutant exons into the genomes of many cells. At five days post-transfection, cells were harvested for gDNA and RNA. After reverse transcription, selective PCR was performed followed by sequencing of gDNA and cDNA derived amplicons. Hexamer enrichment scores were calculated by dividing cDNA counts normalized by gDNA counts. (b) Correlation of enrichment scores between biological replicates for hexamers observed in each experiment with positions of previously identified exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs) and stop codons indicated. (c) Rank-ordered plot of enrichment scores with positions of ESEs, ESSs, and stop codons indicated.
Cloning Sgrna Sequence For Erβ Caccgtctgcagcgattacgcatc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispri+dual+sgrna+libraries/lentiCRISPR+v2+(Plasmid+%2352961)/pmc05739769-241-8-17
Average 96 stars, based on 1 article reviews
cloning sgrna sequence for erβ caccgtctgcagcgattacgcatc - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Addgene inc taok1 sgrnas
( A ) Schematic outline of the kinome shRNA and whole genome CRISPR-Cas9 screens. ( B ) Volcano plot representing gene summary of MAGeCK analysis of the kinome shRNA screens in KB2P-1.21 cells treated with olaparib. ( C ) Volcano plot representing gene summary of MAGeCK analysis of the whole genome CRISPR-Cas9 screens in RPE1-hTERT BRCA1 -/- ;p53 -/- cells treated with 2 Gy IR. ( D, E ) Growth assays in KB2P-3.4 (D) or KB1P-G3 (E) <t>Taok1</t> -/- cell lines treated with the indicated doses of olaparib (D) or IR (E). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Representative images of growth assays in KB1P-G3 NT, Taok1 -/- with empty rescue construct (pOZ-empty) or Taok1 full cDNA rescue construct (pOZ-Taok1) treated with the indicated doses of olaparib. ( G ) Kaplan-Meier survival curve of mice transplanted with KB1P-4S organoids with NT or Taok1 sgRNAs and treated with olaparib. Statistical analysis was performed with the log-rank test. ( H, I ) Growth assays in KB1P-G3 Taok1 -/- cell lines complemented with indicated rescue construct. Cells were treated with indicated doses of olaparib (H) or IR (I). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.
Taok1 Sgrnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispri+dual+sgrna+libraries/pX330-U6-Chimeric_BB-CBh-hSpCas9+(Plasmid+%2342230)/bio_rxiv__2025__10__14__682031-216-11-18
Average 96 stars, based on 1 article reviews
taok1 sgrnas - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

93
Addgene inc sam sgrna library
( A ) Schematic of S1PR1 modulator screening system Four lentiviral vectors were transduced into U2OS cell line to enable gene activation by <t>SAM</t> and monitoring S1PR1 activation by TANGO system. The cells introduced with SAM <t>sgRNA</t> library were starved with 0.5% charcoal treated FBS, then the Venus-positive population was sorted and next-gen sequence (NGS) analysis was carried out to identify the enriched SAM sgRNA sequences. ( B ) Scatter plot showing enrichment of sgRNAs after sorting. Most sgRNAs are equally distributed in the pre-sort sample (closed gray circles) while after sorting a small fraction of sgRNAs (2,770 out of 70,290 sgRNAs) were enriched and others were not detected (open blue circles). The y-axis shows the NGS reads of sgRNAs. ( C ) Identification of top candidate genes using the MAGeCK method . The names of top ten candidate genes are indicated.
Sam Sgrna Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispri+dual+sgrna+libraries/Human+CRISPR+Activation+Library+(SAM+-+3+plasmid+system)+(Pooled+Library+%231000000057%2C+%231000000074)/bio_rxiv__435776-187-16-24
Average 93 stars, based on 1 article reviews
sam sgrna library - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc lenti sgrna blast plasmids
( A ) Schematic of S1PR1 modulator screening system Four lentiviral vectors were transduced into U2OS cell line to enable gene activation by <t>SAM</t> and monitoring S1PR1 activation by TANGO system. The cells introduced with SAM <t>sgRNA</t> library were starved with 0.5% charcoal treated FBS, then the Venus-positive population was sorted and next-gen sequence (NGS) analysis was carried out to identify the enriched SAM sgRNA sequences. ( B ) Scatter plot showing enrichment of sgRNAs after sorting. Most sgRNAs are equally distributed in the pre-sort sample (closed gray circles) while after sorting a small fraction of sgRNAs (2,770 out of 70,290 sgRNAs) were enriched and others were not detected (open blue circles). The y-axis shows the NGS reads of sgRNAs. ( C ) Identification of top candidate genes using the MAGeCK method . The names of top ten candidate genes are indicated.
Lenti Sgrna Blast Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispri+dual+sgrna+libraries/lenti-sgRNA+blast+(Plasmid+%23104993)/pm38335281-279-48-52
Average 93 stars, based on 1 article reviews
lenti sgrna blast plasmids - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc human sgrna library
( A ) Schematic of S1PR1 modulator screening system Four lentiviral vectors were transduced into U2OS cell line to enable gene activation by <t>SAM</t> and monitoring S1PR1 activation by TANGO system. The cells introduced with SAM <t>sgRNA</t> library were starved with 0.5% charcoal treated FBS, then the Venus-positive population was sorted and next-gen sequence (NGS) analysis was carried out to identify the enriched SAM sgRNA sequences. ( B ) Scatter plot showing enrichment of sgRNAs after sorting. Most sgRNAs are equally distributed in the pre-sort sample (closed gray circles) while after sorting a small fraction of sgRNAs (2,770 out of 70,290 sgRNAs) were enriched and others were not detected (open blue circles). The y-axis shows the NGS reads of sgRNAs. ( C ) Identification of top candidate genes using the MAGeCK method . The names of top ten candidate genes are indicated.
Human Sgrna Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispri+dual+sgrna+libraries/Human+CRISPR+Activation+Library+(SAM+-+2+plasmid+system)+(Pooled+Library+%231000000078)/pmc06610048-149-16-21
Average 93 stars, based on 1 article reviews
human sgrna library - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

96
Addgene inc crispr cas9 genomic engineering idt star methods rbns primers idt star methods recombinant dna px458 addgene plasmid
( A ) Schematic of S1PR1 modulator screening system Four lentiviral vectors were transduced into U2OS cell line to enable gene activation by <t>SAM</t> and monitoring S1PR1 activation by TANGO system. The cells introduced with SAM <t>sgRNA</t> library were starved with 0.5% charcoal treated FBS, then the Venus-positive population was sorted and next-gen sequence (NGS) analysis was carried out to identify the enriched SAM sgRNA sequences. ( B ) Scatter plot showing enrichment of sgRNAs after sorting. Most sgRNAs are equally distributed in the pre-sort sample (closed gray circles) while after sorting a small fraction of sgRNAs (2,770 out of 70,290 sgRNAs) were enriched and others were not detected (open blue circles). The y-axis shows the NGS reads of sgRNAs. ( C ) Identification of top candidate genes using the MAGeCK method . The names of top ten candidate genes are indicated.
Crispr Cas9 Genomic Engineering Idt Star Methods Rbns Primers Idt Star Methods Recombinant Dna Px458 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispri+dual+sgrna+libraries/pSpCas9(BB)-2A-GFP+(PX458)+(Plasmid+%2348138)/pm41932309-792-83-97
Average 96 stars, based on 1 article reviews
crispr cas9 genomic engineering idt star methods rbns primers idt star methods recombinant dna px458 addgene plasmid - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

Image Search Results


(a) Experimental schematic. Cultured cells were co-transfected with a single Cas9-sgRNA construct (CRISPR) and a complex homology-directed repair (HDR) library containing an edited exon that harbors a random hexamer (blue, green, orange) and a fixed selective PCR site (red). CRISPR-induced cutting stimulated homologous recombination with the HDR library, inserting mutant exons into the genomes of many cells. At five days post-transfection, cells were harvested for gDNA and RNA. After reverse transcription, selective PCR was performed followed by sequencing of gDNA and cDNA derived amplicons. Hexamer enrichment scores were calculated by dividing cDNA counts normalized by gDNA counts. (b) Correlation of enrichment scores between biological replicates for hexamers observed in each experiment with positions of previously identified exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs) and stop codons indicated. (c) Rank-ordered plot of enrichment scores with positions of ESEs, ESSs, and stop codons indicated.

Journal: Nature

Article Title: Saturation Editing of Genomic Regions by Multiplex Homology-Directed Repair

doi: 10.1038/nature13695

Figure Lengend Snippet: (a) Experimental schematic. Cultured cells were co-transfected with a single Cas9-sgRNA construct (CRISPR) and a complex homology-directed repair (HDR) library containing an edited exon that harbors a random hexamer (blue, green, orange) and a fixed selective PCR site (red). CRISPR-induced cutting stimulated homologous recombination with the HDR library, inserting mutant exons into the genomes of many cells. At five days post-transfection, cells were harvested for gDNA and RNA. After reverse transcription, selective PCR was performed followed by sequencing of gDNA and cDNA derived amplicons. Hexamer enrichment scores were calculated by dividing cDNA counts normalized by gDNA counts. (b) Correlation of enrichment scores between biological replicates for hexamers observed in each experiment with positions of previously identified exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs) and stop codons indicated. (c) Rank-ordered plot of enrichment scores with positions of ESEs, ESSs, and stop codons indicated.

Article Snippet: A bicistronic Cas9-sgRNA vector designed to cleave within BRCA1 exon 18 (“pCas9-sgBRCA1x18”) was cloned according to a published protocol by ligating annealed oligonucleotides into a human codon-optimized S. pyogenous Cas9-sgRNA vector from the lab of Feng Zhang (pX330-U6-Chimeric_BB-CBh-hSpCas9; Addgene plasmid #42230).

Techniques: Cell Culture, Transfection, Construct, CRISPR, Random Hexamer Labeling, Homologous Recombination, Mutagenesis, Sequencing, Derivative Assay

( A ) Schematic outline of the kinome shRNA and whole genome CRISPR-Cas9 screens. ( B ) Volcano plot representing gene summary of MAGeCK analysis of the kinome shRNA screens in KB2P-1.21 cells treated with olaparib. ( C ) Volcano plot representing gene summary of MAGeCK analysis of the whole genome CRISPR-Cas9 screens in RPE1-hTERT BRCA1 -/- ;p53 -/- cells treated with 2 Gy IR. ( D, E ) Growth assays in KB2P-3.4 (D) or KB1P-G3 (E) Taok1 -/- cell lines treated with the indicated doses of olaparib (D) or IR (E). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Representative images of growth assays in KB1P-G3 NT, Taok1 -/- with empty rescue construct (pOZ-empty) or Taok1 full cDNA rescue construct (pOZ-Taok1) treated with the indicated doses of olaparib. ( G ) Kaplan-Meier survival curve of mice transplanted with KB1P-4S organoids with NT or Taok1 sgRNAs and treated with olaparib. Statistical analysis was performed with the log-rank test. ( H, I ) Growth assays in KB1P-G3 Taok1 -/- cell lines complemented with indicated rescue construct. Cells were treated with indicated doses of olaparib (H) or IR (I). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A ) Schematic outline of the kinome shRNA and whole genome CRISPR-Cas9 screens. ( B ) Volcano plot representing gene summary of MAGeCK analysis of the kinome shRNA screens in KB2P-1.21 cells treated with olaparib. ( C ) Volcano plot representing gene summary of MAGeCK analysis of the whole genome CRISPR-Cas9 screens in RPE1-hTERT BRCA1 -/- ;p53 -/- cells treated with 2 Gy IR. ( D, E ) Growth assays in KB2P-3.4 (D) or KB1P-G3 (E) Taok1 -/- cell lines treated with the indicated doses of olaparib (D) or IR (E). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Representative images of growth assays in KB1P-G3 NT, Taok1 -/- with empty rescue construct (pOZ-empty) or Taok1 full cDNA rescue construct (pOZ-Taok1) treated with the indicated doses of olaparib. ( G ) Kaplan-Meier survival curve of mice transplanted with KB1P-4S organoids with NT or Taok1 sgRNAs and treated with olaparib. Statistical analysis was performed with the log-rank test. ( H, I ) Growth assays in KB1P-G3 Taok1 -/- cell lines complemented with indicated rescue construct. Cells were treated with indicated doses of olaparib (H) or IR (I). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: shRNA, CRISPR, Construct

(A) Volcano plot representing gene summary of MAGeCK analysis of the whole genome CRISPR-Cas9 screens in RPE1-hTERT BRCA1 -/- ;p53 -/- cells treated with 1 Gy IR. ( B-E ) Western blot analysis of TAOK1 protein expression of NT and TAOK1 KO in KB2P-3.4 (B), KB1P-G3 including HA-tagged, Taok1 cDNA rescue (pOZ-Taok1) (C), MDA-MB-436 (D) and KB2P-1.21 (E) cell lines. ( F ) TIDE analysis of polyclonal KB2P-1.21 cells. ( G, H ) Growth assays in KB1P-G3 NT, Taok1 -/- and Taok1 rescue cells treated with the indicated doses of olaparib (G) or talazoparib (H). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( I, J ) Growth assays in MDA-MB-436 NT and TAOK1 -/- cell lines treated with indicated doses of olaparib (I) or IR (J). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( K, L ) Growth assays in KB2P-1.21 NT and Taok1 sgRNA cells treated with the indicated doses of olaparib (K) or IR (L). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( M ) TIDE analysis of polyclonal KB1P-4S organoids. ( N ) Immunohistochemistry staining for TAOK1 of untreated BRCA1;p53-deficient mouse mammary tumors with NT or Taok1 sgRNA. ( O ) Olaparib response of KB1P-4S organoids transduced with NT or Taok1 sgRNAs. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: (A) Volcano plot representing gene summary of MAGeCK analysis of the whole genome CRISPR-Cas9 screens in RPE1-hTERT BRCA1 -/- ;p53 -/- cells treated with 1 Gy IR. ( B-E ) Western blot analysis of TAOK1 protein expression of NT and TAOK1 KO in KB2P-3.4 (B), KB1P-G3 including HA-tagged, Taok1 cDNA rescue (pOZ-Taok1) (C), MDA-MB-436 (D) and KB2P-1.21 (E) cell lines. ( F ) TIDE analysis of polyclonal KB2P-1.21 cells. ( G, H ) Growth assays in KB1P-G3 NT, Taok1 -/- and Taok1 rescue cells treated with the indicated doses of olaparib (G) or talazoparib (H). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( I, J ) Growth assays in MDA-MB-436 NT and TAOK1 -/- cell lines treated with indicated doses of olaparib (I) or IR (J). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( K, L ) Growth assays in KB2P-1.21 NT and Taok1 sgRNA cells treated with the indicated doses of olaparib (K) or IR (L). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( M ) TIDE analysis of polyclonal KB1P-4S organoids. ( N ) Immunohistochemistry staining for TAOK1 of untreated BRCA1;p53-deficient mouse mammary tumors with NT or Taok1 sgRNA. ( O ) Olaparib response of KB1P-4S organoids transduced with NT or Taok1 sgRNAs. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: CRISPR, Western Blot, Expressing, Immunohistochemistry, Staining, Transduction

( A-C ) Quantification (A, B) and representative images (C) of growth assays in KB1P-G3B1 WT (A) and KB1P-G3 WT and Taok1 -/- cells treated with the indicated doses of CP 43 and olaparib. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( D ) Western blot analysis of expression level of HA-tagged Taok1 rescue constructs. ( E ) In vitro kinase assay of indicated KB1P-G3 cell lines. Protein was isolated from KB1P-G3 cell lines by co-IP with HA-tag. NT cell line was used as negative control with no HA-tag while the other cell lines expressed an HA-tag with the indicated construct. Bars represent mean ± SD, statistical analysis was done with two-way ANOVA followed by Dunnett’s test. ( F, G ) Representative images of growth assay of KB1P-G3 NT, Taok1 -/- and Taok1 full cDNA rescue (pOZ-Taok1) or two different kinase mutants (pOZ-K57A, pOZ-D169A) and a double mutant (pOZ-K57A+D169A) treated with indicated doses of olaparib (F) or IR (G).

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A-C ) Quantification (A, B) and representative images (C) of growth assays in KB1P-G3B1 WT (A) and KB1P-G3 WT and Taok1 -/- cells treated with the indicated doses of CP 43 and olaparib. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( D ) Western blot analysis of expression level of HA-tagged Taok1 rescue constructs. ( E ) In vitro kinase assay of indicated KB1P-G3 cell lines. Protein was isolated from KB1P-G3 cell lines by co-IP with HA-tag. NT cell line was used as negative control with no HA-tag while the other cell lines expressed an HA-tag with the indicated construct. Bars represent mean ± SD, statistical analysis was done with two-way ANOVA followed by Dunnett’s test. ( F, G ) Representative images of growth assay of KB1P-G3 NT, Taok1 -/- and Taok1 full cDNA rescue (pOZ-Taok1) or two different kinase mutants (pOZ-K57A, pOZ-D169A) and a double mutant (pOZ-K57A+D169A) treated with indicated doses of olaparib (F) or IR (G).

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Western Blot, Expressing, Construct, In Vitro, Kinase Assay, Isolation, Co-Immunoprecipitation Assay, Negative Control, Growth Assay, Mutagenesis

( A ) Graph representing percentage of cells with micronuclei upon 0.5 µM olaparib treatment for 48 h. Bars are plotted as mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( B ) Quantification of RAD51 foci formation upon 10 µM olaparib. Bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( C ) Representative images of RAD51 foci formation upon 10 µM olaparib in Brca1 reconstituted KB1P-G3B1, KB1P-G3 and KB2P-3.4 cell lines with the indicated modifications. ( D ) Quantification of DSB spectrum assay in HEK293T cells treated with the indicated siRNAs. Each dot represents an experiment ran in duplicates, bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( E ) Growth assays of KB1P-G3 NT, Taok1 -/- and TAOK1 rescue cells treated with the indicated doses of cisplatin. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A ) Graph representing percentage of cells with micronuclei upon 0.5 µM olaparib treatment for 48 h. Bars are plotted as mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( B ) Quantification of RAD51 foci formation upon 10 µM olaparib. Bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( C ) Representative images of RAD51 foci formation upon 10 µM olaparib in Brca1 reconstituted KB1P-G3B1, KB1P-G3 and KB2P-3.4 cell lines with the indicated modifications. ( D ) Quantification of DSB spectrum assay in HEK293T cells treated with the indicated siRNAs. Each dot represents an experiment ran in duplicates, bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( E ) Growth assays of KB1P-G3 NT, Taok1 -/- and TAOK1 rescue cells treated with the indicated doses of cisplatin. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Comparison

( A ) Quantification of RAD51 foci formation 3 h post 10 Gy IR. Bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( B ) Verification of siRNA KD efficiency in HEK293T DSB-Spectrum_V1 cell line. ( C ) Growth assays with MDA-MB-436 NT and TAOK1 KO cell lines treated with the indicated doses of cisplatin. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( D, E ) Growth assays in KB1P-G3 NT, TAOK1 KO and Taok1 rescue cell lines treated with indicated doses of carboplatin (D) or oxaliplatin (E). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A ) Quantification of RAD51 foci formation 3 h post 10 Gy IR. Bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( B ) Verification of siRNA KD efficiency in HEK293T DSB-Spectrum_V1 cell line. ( C ) Growth assays with MDA-MB-436 NT and TAOK1 KO cell lines treated with the indicated doses of cisplatin. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( D, E ) Growth assays in KB1P-G3 NT, TAOK1 KO and Taok1 rescue cell lines treated with indicated doses of carboplatin (D) or oxaliplatin (E). Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Comparison

(A) Representative images of IHC staining for TAOK1 on human tumor samples of prostate and lung showing variable nuclear and diffuse cytoplasmatic localization. ( B ) Representative images of IHC staining for TAOK1 on human tumor samples of prostate, bladder and ovary showing varying TAOK1 expression levels. ( C )Western blot analysis of KB1P-G3 NT samples of cytoplasmatic (C) and nuclear (N) fraction and Taok1 -/- whole cell lysate. ( D ) Representative images of immunofluorescence for cellular expression pattern of KB1P-G3 Taok1 -/- cells with HA-tagged pOZ-Taok1 rescue construct compared to pOZ-empty vector control. ( E ) Growth assay in KB1P-G3 NT, Taok1 -/- and Taok1 rescue cell lines treated with indicated doses of camptothecin. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Growth assay in KB2P-3.4 NT and Taok1 -/- clones treated with indicated doses of JH-RE-06 with or without olaparib (0.1 µM). Statistical analysis was performed using two-way ANOVA followed by Tukey’s test. ( G ) DNA fiber analysis in indicated cell lines with or without 4 mM HU treatment (3 h). Bar represents mean of IdU/CldU ratio of at least 250 fibers, statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. (H) DNA fiber analysis in indicated cell lines treated with 10 µM olaparib 2h prior and while labelling with CldU and IdU, ssDNA was digested with S1 nuclease if indicated. Bar represents the mean of IdU track length of at least 250 fibers, statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: (A) Representative images of IHC staining for TAOK1 on human tumor samples of prostate and lung showing variable nuclear and diffuse cytoplasmatic localization. ( B ) Representative images of IHC staining for TAOK1 on human tumor samples of prostate, bladder and ovary showing varying TAOK1 expression levels. ( C )Western blot analysis of KB1P-G3 NT samples of cytoplasmatic (C) and nuclear (N) fraction and Taok1 -/- whole cell lysate. ( D ) Representative images of immunofluorescence for cellular expression pattern of KB1P-G3 Taok1 -/- cells with HA-tagged pOZ-Taok1 rescue construct compared to pOZ-empty vector control. ( E ) Growth assay in KB1P-G3 NT, Taok1 -/- and Taok1 rescue cell lines treated with indicated doses of camptothecin. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Growth assay in KB2P-3.4 NT and Taok1 -/- clones treated with indicated doses of JH-RE-06 with or without olaparib (0.1 µM). Statistical analysis was performed using two-way ANOVA followed by Tukey’s test. ( G ) DNA fiber analysis in indicated cell lines with or without 4 mM HU treatment (3 h). Bar represents mean of IdU/CldU ratio of at least 250 fibers, statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. (H) DNA fiber analysis in indicated cell lines treated with 10 µM olaparib 2h prior and while labelling with CldU and IdU, ssDNA was digested with S1 nuclease if indicated. Bar represents the mean of IdU track length of at least 250 fibers, statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Immunohistochemistry, Expressing, Western Blot, Immunofluorescence, Construct, Plasmid Preparation, Control, Growth Assay, Clone Assay, Comparison

( A ) Quantification of SIRF foci formation of HA-tagged TAOK1 with and without 2 mM HU. Bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( B ) Representative images of analysis shown in ( A ). ( C ) Volcano plot of mass spectrum analysis of TAOK1 co-IP samples from KB1P-G3 NT nuclear fraction compared to TAOK1 KO. Positive log2 fold change values indicate enrichment in the NT nuclear fraction compared to TAOK1 KO of four independent replicas. ( D ) Western blot of input and co-IP of KB1P-G3 NT and TAOK1 KO. Pulldown was performed with PCNA antibody. ( E ) Growth assay of KB1P-G3 NT, TAOK1 KO and TAOK1 rescue cells treated with topotecan at indicated doses. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Growth assay of KB1P-G3 NT, TAOK1 KO and TAOK1 rescue cells treated with JH-RE-06 alone or in combination with olaparib. Statistical analysis was performed using two-way ANOVA followed by Tukey’s test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A ) Quantification of SIRF foci formation of HA-tagged TAOK1 with and without 2 mM HU. Bars represent mean ± SD, statistical analysis was performed using ANOVA followed by Tukey’s multiple comparison test. ( B ) Representative images of analysis shown in ( A ). ( C ) Volcano plot of mass spectrum analysis of TAOK1 co-IP samples from KB1P-G3 NT nuclear fraction compared to TAOK1 KO. Positive log2 fold change values indicate enrichment in the NT nuclear fraction compared to TAOK1 KO of four independent replicas. ( D ) Western blot of input and co-IP of KB1P-G3 NT and TAOK1 KO. Pulldown was performed with PCNA antibody. ( E ) Growth assay of KB1P-G3 NT, TAOK1 KO and TAOK1 rescue cells treated with topotecan at indicated doses. Statistical analysis was performed using two-way ANOVA followed by Dunnett’s test. ( F ) Growth assay of KB1P-G3 NT, TAOK1 KO and TAOK1 rescue cells treated with JH-RE-06 alone or in combination with olaparib. Statistical analysis was performed using two-way ANOVA followed by Tukey’s test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Comparison, Co-Immunoprecipitation Assay, Western Blot, Growth Assay

( A ) Graph showing replication speed by total track length of untreated DNA fiber assay in KB1P-G3 NT and TAOK1 KO cells. Bar represents the mean of at least 250 fibers, statistical analysis was done with unpaired t-test. ( B ) DNA fiber analysis in indicated cell lines with or without 4 mM HU treatment. Bar represents the mean of IdU/CldU ratio of at least 300 fibers, statistical analysis was done with unpaired t-test. ( C ) DNA fiber analysis in indicated cell lines treated with 10 µM olaparib 2h prior and while labelling with CldU and IdU, ssDNA was digested with S1 nuclease if indicated. Bar represents the mean of IdU track length of at least 250 fibers, statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. ( D, E ) Quantification (D) and representative images (E) of immunofluorescence analysis of RPA foci formation in KB1P-G3 NT, TAOK1 KO and TAOK1 rescue cells upon olaparib treatment (10 µM for 16 h). Bars indicate the mean number of foci per nucleus of at least 1000 nuclei. Statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. (F) Western blot of input and co-IP of KB1P-G3 NT and TAOK1 rescue cells. Pulldown was performed with TRIM25 antibody. ( G, H ) Western blot of indicated KB1P-G3 (H) and MDA-MB-436 (I) cell lines for ISG15 protein levels. Cells were untreated or treated with 10 µM olaparib for 24 h. Vinculin was used as loading control. ( I, J ) Schematic predicting replication dynamics in presence (I) or absence of TAOK1 (J) in BRCA1/2-deficient cells. (I) TAOK1 interacts with PCNA and TRIM25 and does not allow alternative fork protection mechanisms or ssDNA gap repair in BRCA-deficient cells, leading to RF instability. (J) In the absence of TAOK1, increased ISG15 expression and potentially recruitment to RF activates fork protection and gap suppression mechanisms and thus, RF stability.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A ) Graph showing replication speed by total track length of untreated DNA fiber assay in KB1P-G3 NT and TAOK1 KO cells. Bar represents the mean of at least 250 fibers, statistical analysis was done with unpaired t-test. ( B ) DNA fiber analysis in indicated cell lines with or without 4 mM HU treatment. Bar represents the mean of IdU/CldU ratio of at least 300 fibers, statistical analysis was done with unpaired t-test. ( C ) DNA fiber analysis in indicated cell lines treated with 10 µM olaparib 2h prior and while labelling with CldU and IdU, ssDNA was digested with S1 nuclease if indicated. Bar represents the mean of IdU track length of at least 250 fibers, statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. ( D, E ) Quantification (D) and representative images (E) of immunofluorescence analysis of RPA foci formation in KB1P-G3 NT, TAOK1 KO and TAOK1 rescue cells upon olaparib treatment (10 µM for 16 h). Bars indicate the mean number of foci per nucleus of at least 1000 nuclei. Statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. (F) Western blot of input and co-IP of KB1P-G3 NT and TAOK1 rescue cells. Pulldown was performed with TRIM25 antibody. ( G, H ) Western blot of indicated KB1P-G3 (H) and MDA-MB-436 (I) cell lines for ISG15 protein levels. Cells were untreated or treated with 10 µM olaparib for 24 h. Vinculin was used as loading control. ( I, J ) Schematic predicting replication dynamics in presence (I) or absence of TAOK1 (J) in BRCA1/2-deficient cells. (I) TAOK1 interacts with PCNA and TRIM25 and does not allow alternative fork protection mechanisms or ssDNA gap repair in BRCA-deficient cells, leading to RF instability. (J) In the absence of TAOK1, increased ISG15 expression and potentially recruitment to RF activates fork protection and gap suppression mechanisms and thus, RF stability.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Comparison, Immunofluorescence, Western Blot, Co-Immunoprecipitation Assay, Control, Expressing

( A, B ) Representative images (A) and quantification (B) of immunofluorescence analysis of RPA foci formation in KB2P-3.4 NT and Taok1 -/- cells upon olaparib treatment (10 µM for 16 h). Bars indicate mean number of foci per nucleus of at least 1000 nuclei. Statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. ( C, D ) Graph representing ssDNA intensity of native BrdU incorporation in KB1P-G3 (C) and MDA-MB-436 (D) cell lines. Cells were treated with 0.75 µM olaparib for 5 h. Ordinary one-way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis. ( E ) Representative images of PLA assay between TRIM25 and HA-tag in KB1P-G3 NT and Taok1 rescue cells. ( F ) Kaplan-Meier curve of survival probability of SCAN-B dataset treated with non-chemotherapy. Statistical analysis was done with log-rank test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A, B ) Representative images (A) and quantification (B) of immunofluorescence analysis of RPA foci formation in KB2P-3.4 NT and Taok1 -/- cells upon olaparib treatment (10 µM for 16 h). Bars indicate mean number of foci per nucleus of at least 1000 nuclei. Statistical analysis was done with ANOVA followed by Tukey’s multiple comparison test. ( C, D ) Graph representing ssDNA intensity of native BrdU incorporation in KB1P-G3 (C) and MDA-MB-436 (D) cell lines. Cells were treated with 0.75 µM olaparib for 5 h. Ordinary one-way ANOVA with Dunnett’s multiple comparison test was used for statistical analysis. ( E ) Representative images of PLA assay between TRIM25 and HA-tag in KB1P-G3 NT and Taok1 rescue cells. ( F ) Kaplan-Meier curve of survival probability of SCAN-B dataset treated with non-chemotherapy. Statistical analysis was done with log-rank test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Immunofluorescence, Comparison, BrdU Incorporation Assay

( A, B ) Analysis of the SCAN-B dataset for TAOK1 high or low expression. Kaplan-Meier curves for survival probability of all patients (A) and patients treated with chemotherapy specifically (B). Risk tables are shown below. Statistical analysis was done with log-rank test.

Journal: bioRxiv

Article Title: TAOK1 regulates chemo- and radiosensitivity in BRCA1/2-deficient tumors

doi: 10.1101/2025.10.14.682031

Figure Lengend Snippet: ( A, B ) Analysis of the SCAN-B dataset for TAOK1 high or low expression. Kaplan-Meier curves for survival probability of all patients (A) and patients treated with chemotherapy specifically (B). Risk tables are shown below. Statistical analysis was done with log-rank test.

Article Snippet: For CRISPR-Cas9 editing of human MDA-MB-436 cell line, NT sgRNA and TAOK1 sgRNAs were cloned into pX330 vector (Addgene, #42230) with puromycin resistance cassette.

Techniques: Expressing

( A ) Schematic of S1PR1 modulator screening system Four lentiviral vectors were transduced into U2OS cell line to enable gene activation by SAM and monitoring S1PR1 activation by TANGO system. The cells introduced with SAM sgRNA library were starved with 0.5% charcoal treated FBS, then the Venus-positive population was sorted and next-gen sequence (NGS) analysis was carried out to identify the enriched SAM sgRNA sequences. ( B ) Scatter plot showing enrichment of sgRNAs after sorting. Most sgRNAs are equally distributed in the pre-sort sample (closed gray circles) while after sorting a small fraction of sgRNAs (2,770 out of 70,290 sgRNAs) were enriched and others were not detected (open blue circles). The y-axis shows the NGS reads of sgRNAs. ( C ) Identification of top candidate genes using the MAGeCK method . The names of top ten candidate genes are indicated.

Journal: bioRxiv

Article Title: Heterotypic inter-GPCR ß-arrestin coupling regulates lymphatic endothelial junctional architecture in murine lymph nodes

doi: 10.1101/435776

Figure Lengend Snippet: ( A ) Schematic of S1PR1 modulator screening system Four lentiviral vectors were transduced into U2OS cell line to enable gene activation by SAM and monitoring S1PR1 activation by TANGO system. The cells introduced with SAM sgRNA library were starved with 0.5% charcoal treated FBS, then the Venus-positive population was sorted and next-gen sequence (NGS) analysis was carried out to identify the enriched SAM sgRNA sequences. ( B ) Scatter plot showing enrichment of sgRNAs after sorting. Most sgRNAs are equally distributed in the pre-sort sample (closed gray circles) while after sorting a small fraction of sgRNAs (2,770 out of 70,290 sgRNAs) were enriched and others were not detected (open blue circles). The y-axis shows the NGS reads of sgRNAs. ( C ) Identification of top candidate genes using the MAGeCK method . The names of top ten candidate genes are indicated.

Article Snippet: The single clones were isolated from antibiotics resistant cells by limiting dilution, then introduced with the SAM sgRNA library (a gift from Feng Zhang, Addgene #1000000057) at a low multiplicity of infection.

Techniques: Activation Assay, Sequencing